Remember, you cannot use any of the Biopython features for your exercise 2, due 3/22/2002.
 

Seq object:
  Before you could use a module or a class it is important to know what attributes or functions/methods it has.
  How you will your figure out what attributes/functions/methods a given module/class has?
 

    >>> seq = 'GAATTCGATAGCTAGCTACGACT'

    Make a Seq object of this seq using unambiguous_dna alphabets and another alphabet of your choice that IUPAc supports.

    How will you obtain the seq string from the Seq object. It is like doing reverse of the above process. Hint: tostring method.

    As expected, the Seq object or string is immutable and thus cannot be changed in place.

    How will you change TTC of the seq string in the Seq object to AAG in place in the Seq object you created above. Hint: tomutable function.
 

Several methods are associated with the MutableSeq class. By the way how you will list what methods this class supports.

Using the MutableSeq class, perform the following operations on your seq, which is otherwise immutable:
1. add the first 3 letters of the seq to the end of seq.
2. remove the first occurence of 'T'
3. reverse the seq, remember only list had the luxury of reversing the order os its elements.

Question 1.
Since the Mutableseq class does not provide a method to get the complement of a DNA sequence. Write python code that creates a class NewMutableSeq that inherits the reverse method of the MutableSeq class and provide a function named complement. How will you obtain the reverse_complement of your input seq using your NewMutableSeq class.

Question 2.

Biopython offers a set of tools in the sequtils.py module. Again, try listing what all attributes/methods/functins it offers. Could you use this module to compute the GC content of a given sequence, i.e., percentage of G plus C.

Question 3.
Biopython also offers a set of tools in Bio.Tools for translation and reverse translation. Could you use this module to translate a given DNA sequence into a polypeptide  sequence and a polypeptide sequence into a DNA sequence using standard genetic code (Don't use the function that you created in exercise2 for this task).
How will you make it stop at the first stop codon?